--- title: "Post-transcriptional modifications exploration and differential proportion analysis" author: Roland Barriot output: html_document: keep_md: true vignette: > %\VignetteIndexEntry{Post-transcriptional_modifications} %\VignetteEngine{knitr::rmarkdown} %\VignetteEncoding{UTF-8} --- # 3'-end post-transcriptional modifications exploration and differential proportion analysis Complete source of this page is available in the notebook [Post-transcriptional_modifications.Rmd](https://gitlab.com/rnaends/rnaends/-/blob/main/vignettes/Post-transcriptional_modifications.Rmd). Based on the publication from Xu X, Usher B, Gutierrez C, Barriot R, Arrowsmith TJ, Han X, Redder P, Neyrolles O, Blower TR, Genevaux P (2023) MenT nucleotidyltransferase toxins extend tRNA acceptor stems and can be inhibited by asymmetrical antitoxin binding. Nature Communications, 14, 4644. [https://doi.org/10.1038/s41467-023-40264-3](https://doi.org/10.1038/s41467-023-40264-3). ## Download dataset Data accompanying the article are publicly available on European Nucleotide Archive (ENA) at EBI https://www.ebi.ac.uk/ena/browser/view/PRJEB62085 For this notebook, we will use some RNA-Seq samples multiplexed into one raw FASTQ file to reproduce some results on the action of toxin MenT1 which adds ribonucleotides at the 3'-end of tRNAs as illustrated in [figure 3E of the original paper](https://www.nature.com/articles/s41467-023-40264-3/figures/3). The dataset will be directly downloaded in the [../extdata/MenT1](../extdata/MenT1) directory of the project (that should be readily available if the GitLab project is cloned). The initial [../extdata/MenT1](../extdata/MenT1) directory contains also the reference sequences of the tRNAs (multifasta file) to which we will align the 3'-end sequencing reads: [Msm.reference.tRNAs.with.CCA.fasta](../extdata/MenT1/Msm.reference.tRNAs.with.CCA.fasta). ``` r library(rnaends) ``` ``` r library(tidyverse) #> ── Attaching core tidyverse packages ──────────────────────── tidyverse 2.0.0 ── #> ✔ dplyr 1.1.4 ✔ readr 2.1.5 #> ✔ forcats 1.0.0 ✔ stringr 1.5.1 #> ✔ ggplot2 3.5.1 ✔ tibble 3.2.1 #> ✔ lubridate 1.9.4 ✔ tidyr 1.3.1 #> ✔ purrr 1.0.2 #> ── Conflicts ────────────────────────────────────────── tidyverse_conflicts() ── #> ✖ dplyr::filter() masks stats::filter() #> ✖ dplyr::lag() masks stats::lag() #> ℹ Use the conflicted package () to force all conflicts to become errors ``` ``` r options(width = 250) data_dir <- "../extdata/MenT1" raw_fastq <- paste0(data_dir, "/Msm.total.RNA.MenT1.Library.fq.gz") if (!file.exists(raw_fastq)) download.file("ftp://ftp.sra.ebi.ac.uk/vol1/run/ERR114/ERR11439143/Msm.total.RNA.MenT1.Library.fq.gz", destfile = raw_fastq) ``` ## Pre-processing of reads prior mapping In this section, we will parse the raw reads to: * validate their content * split the FASTQ file into 4 different FASTQ files, each one of them corresponding to a sample: control without toxin or tRNAs with toxin and replicate 1 or 2 For more information on the other pre-processing features available, see the vignette on pre-processing features. The reads are 100 nt long and their structure can be schematized as follows: ``` read position: 1 2 6 25 40 46 N · multiplexing barcode · recognition sequence · UMI · control sequence · 3'-5' tRNA-end reverse complement │ │ │ │ │ └ 55nt long │ │ │ │ └ must be AGATAC │ │ │ └ 15 random nucleotides (A, T, C or G) serving as │ │ │ Unique Molecule Identifier (UMI) for PCR duplicates removal │ │ └ must be CGGCACCAACCGAGGCTCA │ └ must be one of ACAC, ATTG, GACG or GGTA │ └ one random nucleotide at the beginning ``` Here, we define the authorized barcodes and their associated experimental condition (in same order) so that we can reuse them later. ``` r barcodes <- c("ACAC", "ATTG", "GACG", "GGTA") conditions <- c("ctrl.r1", "ctrl.r2", "MenT1.r1", "MenT1.r2") ``` The above schematized structure is translated to a `read_features` table that will be used for reads parsing and validation. For its initialization, the user must specify which region on the reads contains the sequence destined to be aligned on the reference sequences. ``` r read_features <- init_read_features(start = 46, width = 55) # region to map read_features %>% knitr::kable() ``` |name | start| width|pattern_type |pattern | max_mismatch|readid_prepend | |:-------|-----:|-----:|:------------|:-------|------------:|:--------------| |readseq | 46| 55|nucleotides |ACTG | 0|FALSE | Then, the table is updated with each structure element of the reads. The barcode from position 2 to 5 is a feature of type "constant" which is a set of authorized constant string at a certain location: ``` r read_features <- add_read_feature(read_features, name = "barcode", start = 2, width = 4, pattern = barcodes, pattern_type = "constant") ``` The UMI from position 25 to 39 are composed of A, T, C or G, thus is a feature of type "nucleotides" which is a string composed of a certain alphabet. This feature will be extracted and stored in the read identifier for future use in the quantification step (to remove PCR duplicates), thus the `readid_prepend = TRUE` argument). ``` r read_features <- add_read_feature(read_features, name = "UMI", start = 25, width = 15, pattern = "ACGT", pattern_type = "nucleotides", readid_prepend = TRUE) ``` Then, the recognition sequence and the control sequence correspond to constant character strings and will be used to validate the reads. These are features of type "constant". ``` r read_features <- add_read_feature(read_features, name = "recognition_seq", start = 6, width = 19, pattern = "CGGCACCAACCGAGGCTCA", pattern_type = "constant", max_mismatch = 1, readid_prepend = FALSE) read_features <- add_read_feature(read_features, name = "control_seq", start = 40, width = 6, pattern = "AGATAC", pattern_type = "constant", readid_prepend = FALSE) read_features %>% knitr::kable() ``` |name | start| width|pattern_type |pattern | max_mismatch|readid_prepend | |:---------------|-----:|-----:|:------------|:------------|------------:|:--------------| |readseq | 46| 55|nucleotides |ACTG | 0|FALSE | |barcode | 2| 4|constant |ACAC, AT.... | 0|FALSE | |UMI | 25| 15|nucleotides |ACGT | 0|TRUE | |recognition_seq | 6| 19|constant |CGGCACCA.... | 1|FALSE | |control_seq | 40| 6|constant |AGATAC | 0|FALSE | Once the `read`_features` table is defined, parsing of read can be performed. As we need also to demultiplex the samples here, we will directly call `demultiplex` which will call the `parse_read` internally to parse and validate the reads. ## Demultiplex original raw FASTQ file(s) into separate FASTQ files Reads are validated against the read features and only valid reads are found in the demultiplexed FASTQ files. ``` r demux_report <- demultiplex(fastq_file = raw_fastq, yieldsize = 1e6, # number of reads parsed at each iteration features = read_features, force = FALSE, # demultiplex will not do anything if there already exists a report keep_invalid_reads = FALSE) # FALSE: we do not want invalid reads to be returned in a separate FASTQ file #> Demux report already exists set force=T to overwrite: ../extdata/MenT1/Msm.total.RNA.MenT1.Library_demux/Msm.total.RNA.MenT1.Library_parse_report.csv demux_report %>% knitr::kable() ``` |barcode_group |is_valid_readseq |is_valid_barcode |is_valid_UMI |is_valid_recognition_seq |is_valid_control_seq | count|demux_filename | |:-------------|:----------------|:----------------|:------------|:------------------------|:--------------------|-------:|:-----------------------------------------------------------------------------------------------| |ACAC |FALSE |TRUE |TRUE |TRUE |TRUE | 39|NA | |ACAC |TRUE |TRUE |TRUE |TRUE |TRUE | 996140|../data/MenT1/Msm.total.RNA.MenT1.Library_demux/Msm.total.RNA.MenT1.Library_ACAC_valid.fastq.gz | |ATTG |FALSE |TRUE |TRUE |TRUE |TRUE | 35|NA | |ATTG |TRUE |TRUE |TRUE |TRUE |TRUE | 761196|../data/MenT1/Msm.total.RNA.MenT1.Library_demux/Msm.total.RNA.MenT1.Library_ATTG_valid.fastq.gz | |GACG |FALSE |TRUE |TRUE |TRUE |TRUE | 25|NA | |GACG |TRUE |TRUE |TRUE |TRUE |TRUE | 614477|../data/MenT1/Msm.total.RNA.MenT1.Library_demux/Msm.total.RNA.MenT1.Library_GACG_valid.fastq.gz | |GGTA |FALSE |TRUE |TRUE |TRUE |TRUE | 39|NA | |GGTA |TRUE |TRUE |TRUE |TRUE |TRUE | 1059530|../data/MenT1/Msm.total.RNA.MenT1.Library_demux/Msm.total.RNA.MenT1.Library_GGTA_valid.fastq.gz | The report provides statistics on reads for each sample together with the fastq output file. ## Mapping of reads and quantification of 3'-ends abundances in a count table As, reads should align partially, we will use subread. ``` r # input demux_dir <- paste0(sub("(.fastq|.fq)(.gz)?$", "", raw_fastq), "_demux") fastq_files <- demux_report$demux_filename %>% na.omit() # params for mapping reference_genome <- "Msm.reference.tRNAs.with.CCA.fasta" reference_fasta <- paste0(data_dir, "/", reference_genome) reference_index <- paste0(data_dir, "/", reference_genome, ".subread") aligner <- "subread" max_mismatch <- 0 bam_dir <- paste0(demux_dir, "/mm", max_mismatch, "_", aligner, "_", reference_genome) # perform mapping bam_files <- lapply( fastq_files, map_fastq, fasta_name = reference_fasta, index_name = reference_index, max_map_mismatch = max_mismatch, aligner = aligner, force = FALSE, bam_dir = bam_dir, threads = 4 ) #> bam_file '../extdata/MenT1/Msm.total.RNA.MenT1.Library_demux/mm0_subread_Msm.reference.tRNAs.with.CCA.fasta/Msm.total.RNA.MenT1.Library_ACAC_valid.fastq.gz.bam' already exists, set force=TRUE to recompute #> bam_file '../extdata/MenT1/Msm.total.RNA.MenT1.Library_demux/mm0_subread_Msm.reference.tRNAs.with.CCA.fasta/Msm.total.RNA.MenT1.Library_ATTG_valid.fastq.gz.bam' already exists, set force=TRUE to recompute #> bam_file '../extdata/MenT1/Msm.total.RNA.MenT1.Library_demux/mm0_subread_Msm.reference.tRNAs.with.CCA.fasta/Msm.total.RNA.MenT1.Library_GACG_valid.fastq.gz.bam' already exists, set force=TRUE to recompute #> bam_file '../extdata/MenT1/Msm.total.RNA.MenT1.Library_demux/mm0_subread_Msm.reference.tRNAs.with.CCA.fasta/Msm.total.RNA.MenT1.Library_GGTA_valid.fastq.gz.bam' already exists, set force=TRUE to recompute ``` ## Convert bam files to count table with `quantify_3prime` The `quantify_3prime` is called on each BAM file. The `features` table is passed to take into account the UMIs that were present in the reads to remove duplicates. ``` r count_table <- quantify_from_bam_files(bam_files, conditions, quantify_3prime, features = read_features, min_mapped_length = 20, rev_comp_reads = TRUE, keep_UMI = FALSE) #> Quantification 3' output file exists, set force=T to overwrite: ../extdata/MenT1/Msm.total.RNA.MenT1.Library_demux/mm0_subread_Msm.reference.tRNAs.with.CCA.fasta/Msm.total.RNA.MenT1.Library_ACAC_valid.fastq.gz.bam.csv #> Quantification 3' output file exists, set force=T to overwrite: ../extdata/MenT1/Msm.total.RNA.MenT1.Library_demux/mm0_subread_Msm.reference.tRNAs.with.CCA.fasta/Msm.total.RNA.MenT1.Library_ATTG_valid.fastq.gz.bam.csv #> Quantification 3' output file exists, set force=T to overwrite: ../extdata/MenT1/Msm.total.RNA.MenT1.Library_demux/mm0_subread_Msm.reference.tRNAs.with.CCA.fasta/Msm.total.RNA.MenT1.Library_GACG_valid.fastq.gz.bam.csv #> Quantification 3' output file exists, set force=T to overwrite: ../extdata/MenT1/Msm.total.RNA.MenT1.Library_demux/mm0_subread_Msm.reference.tRNAs.with.CCA.fasta/Msm.total.RNA.MenT1.Library_GGTA_valid.fastq.gz.bam.csv count_table %>% head(15) %>% knitr::kable() ``` |sample_id |rname | position|strand |downstream_seq | reads| count| |:---------|:------------------|--------:|:------|:-------------------------------|-----:|-----:| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACACAG | 1| 1| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACACAGGCAGTGTGGGGGCCAGG | 1| 1| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACACAGGCAGTGTGGGGGT | 1| 1| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACACGGGCAGT | 1| 1| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACACGGGCAGTGTGGGGGCCAGGGGTTA | 1| 1| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACACGGGCAGTGTGGGGGTCAGG | 1| 1| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACACGGGCAGTGTGGGGGTTAGG | 1| 1| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACACTGGGAGT | 1| 1| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACACTGGTAG | 1| 1| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACACTGGTAGT | 1| 1| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACACTGGTAGTGTGGGGGTCAGGG | 1| 1| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACACTGTCTCCTAGGCTCCACCA | 1| 1| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACACTTGCAGTGTGTGGGTCAGGG | 1| 1| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACAGTGCTGCACGGCGGTCTGATC | 1| 1| |ctrl.r1 |Msm.Ala-CGC.trna33 | 25|+ |ACCACAGTGGCAGT | 1| 1| ## Downstream analysis: 3'-end post-transciptional modifications exploration Pivot `count_table` to have counts for each sample for the same 3'-end. For noise reduction, we will only keep rows for which there are at least 10 reads in one sample. ``` r count_table_w <- count_table %>% select(-reads) %>% pivot_wider(names_from = "sample_id", values_from = "count", values_fill = 0) %>% filter(if_any(all_of(conditions), ~ . >= 10)) count_table_w %>% head(15) %>% knitr::kable() ``` |rname | position|strand |downstream_seq | ctrl.r1| ctrl.r2| MenT1.r1| MenT1.r2| |:------------------|--------:|:------|:--------------|-------:|-------:|--------:|--------:| |Msm.Ala-CGC.trna33 | 26|+ | | 137| 2| 6| 145| |Msm.Ala-CGC.trna33 | 27|+ | | 130| 12| 15| 151| |Msm.Ala-CGC.trna33 | 28|+ | | 79| 5| 12| 86| |Msm.Ala-CGC.trna33 | 29|+ | | 75| 12| 15| 93| |Msm.Ala-CGC.trna33 | 30|+ | | 58| 27| 25| 78| |Msm.Ala-CGC.trna33 | 31|+ | | 62| 5| 8| 78| |Msm.Ala-CGC.trna33 | 32|+ | | 36| 5| 5| 41| |Msm.Ala-CGC.trna33 | 33|+ | | 72| 31| 29| 91| |Msm.Ala-CGC.trna33 | 34|+ | | 72| 99| 106| 99| |Msm.Ala-CGC.trna33 | 35|+ | | 142| 341| 382| 166| |Msm.Ala-CGC.trna33 | 36|+ | | 167| 44| 55| 150| |Msm.Ala-CGC.trna33 | 37|+ | | 158| 107| 95| 115| |Msm.Ala-CGC.trna33 | 38|+ | | 66| 13| 8| 59| |Msm.Ala-CGC.trna33 | 39|+ | | 113| 18| 20| 106| |Msm.Ala-CGC.trna33 | 40|+ | | 146| 8| 6| 132| Next, we are going to focus on full length tRNAs. Thus, we will need their length. tRNAs with expected length from reference sequences FASTA file: ``` r library(Biostrings) tRNAs_DNASS <- readDNAStringSet(paste0(data_dir, "/", reference_genome)) tRNAs <- tibble(rlength = width(tRNAs_DNASS), seq = as.character(tRNAs_DNASS), name = names(tRNAs_DNASS)) %>% mutate(id = str_extract(name, "trna\\d+.\\S+"), rname = as.factor(str_extract(name, "^\\S+"))) %>% select(rname, rlength, seq) tRNAs %>% head(15) %>% knitr::kable() ``` |rname | rlength|seq | |:------------------|-------:|:-----------------------------------------------------------------------------| |Msm.Ala-CGC.trna33 | 76|GGGGCTATGGCGCAGTTGGTAGCGCGACTCGTTCGCATCGAGTAGGTCAGGGGTTCGATTCCCCTTAGCTCCACCA | |Msm.Ala-GGC.trna9 | 76|GGGGCTATGGCGCAGTTGGTAGCGCACCACACTGGCAGTGTGGGGGTCAGGGGTTCGAATCCCCTTAGCTCCACCA | |Msm.Ala-TGC.trna2 | 76|GGGGCCTTAGCTCAGTTGGTAGAGCGCTGCCTTTGCAAGGCAGATGTCAGGAGTTCGAATCTCCTAGGCTCCACCA | |Msm.Arg-ACG.trna27 | 76|GCGCCCGTAGCTCAACGGATAGAGCATCTGACTACGGATCAGAAGGTTAGGGGTTCGAATCCCTTCGGGCGCACCA | |Msm.Arg-TCT.trna15 | 76|GCCTCCGTAGCTCAATGGATAGAGCATCGGCCTTCTAATCCGACGGTTGCAGGTTCGAGTCCTGCCGGGGGCGCCA | |Msm.Arg-CCG.trna18 | 76|GCCCCCGTAGCTCAGGGGATAGAGCGTCTGCCTCCGGAGCAGAAGGCCGCAGGTTCGAATCCTGCCGGGGGCACCA | |Msm.Arg-CCT.trna20 | 76|GCCCTCGTAGCTCAGGGGATAGAGCACGGCTCTCCTAAAGCCGGTGTCGCAGGTTCGAATCCTGCCGGGGGCACCA | |Msm.Asn-GTT.trna37 | 76|TCCCCTGTAGCTCAATTGGCAGAGCATTCGGCTGTTAACCGAAGGGTTGCTGGTTCGAGTCCAGCCGGGGGAGCCA | |Msm.Asp-GTC.trna31 | 77|GGCCCTGTGGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGCGGGTTCAAGTCCCGTCAGGGTCGCCA | |Msm.Cys-GCA.trna40 | 74|GCGGGTGTGGCTGAGTGGCTAGGCAGCGGCCTGCAAAGCCGTCTACACGGGTTCGAGTCCCGTCACTCGCTCCA | |Msm.Cys-GCA.trna44 | 74|GGTGGAGTGGCCGAGTGGTGAGGCAACGGCCTGCAAAGCCGTGCACACGGGTTCGATTCCCGTCTCCACCTCCA | |Msm.Gln-CTG.trna10 | 75|TGGGGTATGGTGTAATTGGCAACACAGCTGATTCTGGTTCAGCCATTCTAGGTTCGAGTCCTGGTACCCCAGCCA | |Msm.Gln-TTG.trna19 | 75|TCCGTCGTGGTGTAATCGGCAGCACCTCTGATTTTGGTTCAGATAGTTCAGGTTCGAGTCCTGGCGACGGAGCCA | |Msm.Glu-CTC.trna11 | 76|GCCCCCGTCGTCTAGCGGCCTAGGACGCCGCCCTCTCACGGCGGTAGCGTGGGTTCGAATCCCATCGGGGGTACCA | |Msm.Glu-TTC.trna30 | 76|GCCCCCATCGTCTAGTGGCCTAGGACGCCGCCCTTTCACGGCGGTAGCACGGGTTCGAATCCCGTTGGGGGTACCA | Filter only full length tRNAs with or without Cs added post-transcriptionaly ``` r count_table_w <- tRNAs %>% select(-seq) %>% inner_join(count_table_w, by = join_by(rname)) %>% filter(position == rlength, str_detect(downstream_seq, pattern = "^C*$")) count_table_w %>% knitr::kable() ``` |rname | rlength| position|strand |downstream_seq | ctrl.r1| ctrl.r2| MenT1.r1| MenT1.r2| |:------------------|-------:|--------:|:------|:--------------|-------:|-------:|--------:|--------:| |Msm.Ala-CGC.trna33 | 76| 76|+ | | 74878| 35268| 14950| 49270| |Msm.Ala-CGC.trna33 | 76| 76|+ |C | 48| 6| 5062| 23377| |Msm.Ala-CGC.trna33 | 76| 76|+ |CC | 251| 50| 774| 9423| |Msm.Ala-CGC.trna33 | 76| 76|+ |CCC | 132| 22| 49| 655| |Msm.Ala-CGC.trna33 | 76| 76|+ |CCCC | 12| 1| 6| 50| |Msm.Ala-GGC.trna9 | 76| 76|+ | | 117766| 46916| 23538| 91997| |Msm.Ala-GGC.trna9 | 76| 76|+ |C | 60| 9| 8894| 38132| |Msm.Ala-GGC.trna9 | 76| 76|+ |CC | 273| 49| 992| 10477| |Msm.Ala-GGC.trna9 | 76| 76|+ |CCC | 135| 23| 75| 722| |Msm.Ala-GGC.trna9 | 76| 76|+ |CCCC | 25| 2| 4| 60| |Msm.Ala-TGC.trna2 | 76| 76|+ | | 3696| 1322| 660| 2249| |Msm.Ala-TGC.trna2 | 76| 76|+ |C | 3| 0| 180| 529| |Msm.Ala-TGC.trna2 | 76| 76|+ |CC | 4| 0| 11| 133| |Msm.Arg-CCG.trna18 | 76| 76|+ | | 19830| 39402| 24566| 20289| |Msm.Arg-CCG.trna18 | 76| 76|+ |C | 37| 3| 10869| 10466| |Msm.Arg-CCG.trna18 | 76| 76|+ |CC | 27| 8| 313| 185| |Msm.Arg-CCG.trna18 | 76| 76|+ |CCC | 10| 2| 21| 15| |Msm.Arg-CCT.trna20 | 76| 76|+ | | 2006| 1427| 871| 1834| |Msm.Arg-CCT.trna20 | 76| 76|+ |CC | 4| 0| 25| 79| |Msm.Arg-CCT.trna20 | 76| 76|+ |C | 0| 0| 322| 593| |Msm.Asn-GTT.trna37 | 76| 76|+ | | 5045| 1582| 1101| 3803| |Msm.Asn-GTT.trna37 | 76| 76|+ |CC | 6| 1| 22| 157| |Msm.Asn-GTT.trna37 | 76| 76|+ |C | 0| 0| 188| 925| |Msm.Asp-GTC.trna31 | 77| 77|+ | | 1187| 430| 161| 490| |Msm.Asp-GTC.trna31 | 77| 77|+ |CC | 1| 0| 4| 13| |Msm.Asp-GTC.trna31 | 77| 77|+ |C | 0| 0| 51| 143| |Msm.Cys-GCA.trna44 | 74| 74|+ | | 15287| 2177| 1418| 12162| |Msm.Cys-GCA.trna44 | 74| 74|+ |C | 14| 5| 742| 7331| |Msm.Cys-GCA.trna44 | 74| 74|+ |CC | 19| 5| 52| 736| |Msm.Cys-GCA.trna44 | 74| 74|+ |CCC | 19| 2| 0| 35| |Msm.Gln-CTG.trna10 | 75| 75|+ | | 2025| 1696| 1279| 1536| |Msm.Gln-CTG.trna10 | 75| 75|+ |C | 1| 1| 208| 289| |Msm.Gln-CTG.trna10 | 75| 75|+ |CC | 7| 1| 17| 51| |Msm.Glu-CTC.trna11 | 76| 76|+ | | 369| 454| 154| 190| |Msm.Glu-CTC.trna11 | 76| 76|+ |C | 0| 0| 48| 20| |Msm.Glu-TTC.trna30 | 76| 76|+ | | 20182| 48205| 20106| 10764| |Msm.Glu-TTC.trna30 | 76| 76|+ |C | 17| 3| 5826| 1919| |Msm.Glu-TTC.trna30 | 76| 76|+ |CC | 19| 4| 671| 334| |Msm.Glu-TTC.trna30 | 76| 76|+ |CCC | 2| 0| 57| 12| |Msm.Gly-GCC.trna43 | 76| 76|+ | | 323| 68| 27| 139| |Msm.Gly-GCC.trna43 | 76| 76|+ |C | 0| 0| 5| 37| |Msm.Gly-TCC.trna14 | 74| 74|+ | | 14279| 7436| 3028| 13502| |Msm.Gly-TCC.trna14 | 74| 74|+ |C | 25| 2| 2041| 8300| |Msm.Gly-TCC.trna14 | 74| 74|+ |CC | 59| 10| 165| 821| |Msm.Gly-TCC.trna14 | 74| 74|+ |CCC | 50| 15| 5| 76| |Msm.Gly-TCC.trna14 | 74| 74|+ |CCCC | 33| 2| 5| 34| |Msm.Gly-TCC.trna14 | 74| 74|+ |CCCCC | 4| 1| 1| 12| |Msm.His-GTG.trna16 | 76| 76|+ | | 227| 35| 16| 84| |Msm.His-GTG.trna16 | 76| 76|+ |C | 0| 0| 2| 32| |Msm.Ile-GAT.trna1 | 77| 77|+ | | 22255| 11100| 7542| 20170| |Msm.Ile-GAT.trna1 | 77| 77|+ |C | 11| 1| 1168| 4340| |Msm.Ile-GAT.trna1 | 77| 77|+ |CC | 16| 6| 118| 645| |Msm.Ile-GAT.trna1 | 77| 77|+ |CCC | 7| 0| 5| 34| |Msm.Leu-CAA.trna42 | 77| 77|+ | | 13281| 3553| 1655| 7642| |Msm.Leu-CAA.trna42 | 77| 77|+ |C | 7| 2| 578| 2357| |Msm.Leu-CAA.trna42 | 77| 77|+ |CC | 10| 0| 42| 223| |Msm.Leu-CAA.trna42 | 77| 77|+ |CCC | 7| 2| 5| 17| |Msm.Leu-CAG.trna3 | 86| 86|+ | | 103054| 76258| 42932| 70265| |Msm.Leu-CAG.trna3 | 86| 86|+ |C | 50| 12| 16217| 20681| |Msm.Leu-CAG.trna3 | 86| 86|+ |CC | 93| 22| 1178| 2112| |Msm.Leu-CAG.trna3 | 86| 86|+ |CCC | 55| 7| 59| 209| |Msm.Leu-CAG.trna3 | 86| 86|+ |CCCC | 6| 8| 3| 20| |Msm.Leu-GAG.trna13 | 89| 89|+ | | 12366| 17017| 11314| 12197| |Msm.Leu-GAG.trna13 | 89| 89|+ |C | 16| 2| 3619| 2905| |Msm.Leu-GAG.trna13 | 89| 89|+ |CC | 15| 0| 476| 559| |Msm.Leu-GAG.trna13 | 89| 89|+ |CCC | 29| 5| 32| 67| |Msm.Leu-GAG.trna13 | 89| 89|+ |CCCC | 5| 2| 5| 12| |Msm.Lys-CTT.trna17 | 76| 76|+ | | 16554| 8047| 5428| 10114| |Msm.Lys-CTT.trna17 | 76| 76|+ |C | 11| 0| 1049| 1716| |Msm.Lys-CTT.trna17 | 76| 76|+ |CC | 21| 2| 131| 517| |Msm.Lys-CTT.trna17 | 76| 76|+ |CCC | 9| 1| 11| 48| |Msm.Lys-TTT.trna21 | 76| 76|+ | | 1532| 668| 382| 1137| |Msm.Lys-TTT.trna21 | 76| 76|+ |CC | 3| 0| 6| 37| |Msm.Lys-TTT.trna21 | 76| 76|+ |C | 0| 0| 81| 234| |Msm.Met-CAT.trna8 | 77| 77|+ | | 38| 8| 4| 21| |Msm.Met-CAT.trna6 | 77| 77|+ | | 20| 4| 2| 4| |Msm.Pro-CGG.trna23 | 77| 77|+ | | 3601| 2261| 1796| 3718| |Msm.Pro-CGG.trna23 | 77| 77|+ |C | 2| 1| 337| 758| |Msm.Pro-CGG.trna23 | 77| 77|+ |CC | 2| 0| 13| 57| |Msm.Pro-GGG.trna41 | 77| 77|+ | | 73943| 65589| 36733| 57991| |Msm.Pro-GGG.trna41 | 77| 77|+ |C | 50| 6| 8934| 21092| |Msm.Pro-GGG.trna41 | 77| 77|+ |CC | 141| 26| 687| 3624| |Msm.Pro-GGG.trna41 | 77| 77|+ |CCC | 103| 16| 44| 220| |Msm.Pro-GGG.trna41 | 77| 77|+ |CCCC | 9| 5| 5| 25| |Msm.Pro-TGG.trna36 | 77| 77|+ | | 37| 37| 7| 18| |Msm.SeC-TCA.trna46 | 95| 95|+ | | 199| 322| 166| 187| |Msm.SeC-TCA.trna46 | 95| 95|+ |C | 1| 0| 46| 46| |Msm.SeC-TCA.trna46 | 95| 95|+ |CC | 0| 0| 4| 10| |Msm.Ser-CGA.trna28 | 91| 91|+ | | 190| 36| 18| 147| |Msm.Ser-CGA.trna28 | 91| 91|+ |C | 0| 0| 3| 34| |Msm.Ser-GCT.trna26 | 92| 92|+ | | 523| 300| 104| 523| |Msm.Ser-GCT.trna26 | 92| 92|+ |C | 0| 0| 10| 93| |Msm.Ser-GGA.trna24 | 89| 89|+ | | 15842| 6155| 2893| 11747| |Msm.Ser-GGA.trna24 | 89| 89|+ |C | 11| 2| 709| 4548| |Msm.Ser-GGA.trna24 | 89| 89|+ |CC | 4| 1| 49| 504| |Msm.Ser-GGA.trna24 | 89| 89|+ |CCC | 0| 3| 3| 22| |Msm.Ser-TGA.trna25 | 90| 90|+ | | 26| 13| 3| 21| |Msm.Thr-CGT.trna29 | 76| 76|+ | | 319| 103| 34| 157| |Msm.Thr-CGT.trna29 | 76| 76|+ |C | 1| 0| 7| 41| |Msm.Thr-GGT.trna5 | 76| 76|+ | | 11120| 10371| 5789| 5106| |Msm.Thr-GGT.trna5 | 76| 76|+ |C | 11| 0| 1327| 1660| |Msm.Thr-GGT.trna5 | 76| 76|+ |CC | 8| 1| 75| 170| |Msm.Thr-TGT | 75| 75|+ | | 76| 16| 2| 47| |Msm.Thr-TGT | 75| 75|+ |C | 0| 0| 0| 37| |Msm.Trp-CCA.trna7 | 76| 76|+ | | 104| 13| 8| 32| |Msm.Tyr-GTA.trna4 | 86| 86|+ | | 411| 127| 83| 273| |Msm.Tyr-GTA.trna4 | 86| 86|+ |C | 0| 0| 28| 97| |Msm.Tyr-GTA.trna4 | 86| 86|+ |CC | 0| 0| 3| 27| |Msm.Val-CAC.trna12 | 75| 75|+ | | 952| 540| 327| 916| |Msm.Val-CAC.trna12 | 75| 75|+ |C | 2| 0| 45| 133| |Msm.Val-CAC.trna12 | 75| 75|+ |CC | 1| 0| 5| 40| |Msm.Val-GAC.trna45 | 75| 75|+ | | 54835| 25926| 17708| 51804| |Msm.Val-GAC.trna45 | 75| 75|+ |C | 13| 0| 2205| 7261| |Msm.Val-GAC.trna45 | 75| 75|+ |CC | 61| 9| 212| 1511| |Msm.Val-GAC.trna45 | 75| 75|+ |CCC | 17| 5| 15| 68| ## Visualize proportions of post-transcriptional modifications with bar plots Pivot to longer format to compute proportions per tRNA per condition ``` r count_table_l <- count_table_w %>% pivot_longer(cols = all_of(conditions), names_to = "condition", values_to = "count") count_per_tRNA_per_sample <- count_table_l %>% group_by(condition, rname) %>% summarise(total=sum(count), .groups = "keep") %>% select(condition, rname, total) # totals and percentages count_table_l <- count_table_l %>% inner_join(count_per_tRNA_per_sample, by = c("condition", "rname")) %>% mutate(pc = round(count / total * 100, 1)) %>% relocate(pc, .after = count) count_table_l %>% head(15) %>% knitr::kable() ``` |rname | rlength| position|strand |downstream_seq |condition | count| pc| total| |:------------------|-------:|--------:|:------|:--------------|:---------|-----:|----:|-----:| |Msm.Ala-CGC.trna33 | 76| 76|+ | |ctrl.r1 | 74878| 99.4| 75321| |Msm.Ala-CGC.trna33 | 76| 76|+ | |ctrl.r2 | 35268| 99.8| 35347| |Msm.Ala-CGC.trna33 | 76| 76|+ | |MenT1.r1 | 14950| 71.7| 20841| |Msm.Ala-CGC.trna33 | 76| 76|+ | |MenT1.r2 | 49270| 59.5| 82775| |Msm.Ala-CGC.trna33 | 76| 76|+ |C |ctrl.r1 | 48| 0.1| 75321| |Msm.Ala-CGC.trna33 | 76| 76|+ |C |ctrl.r2 | 6| 0.0| 35347| |Msm.Ala-CGC.trna33 | 76| 76|+ |C |MenT1.r1 | 5062| 24.3| 20841| |Msm.Ala-CGC.trna33 | 76| 76|+ |C |MenT1.r2 | 23377| 28.2| 82775| |Msm.Ala-CGC.trna33 | 76| 76|+ |CC |ctrl.r1 | 251| 0.3| 75321| |Msm.Ala-CGC.trna33 | 76| 76|+ |CC |ctrl.r2 | 50| 0.1| 35347| |Msm.Ala-CGC.trna33 | 76| 76|+ |CC |MenT1.r1 | 774| 3.7| 20841| |Msm.Ala-CGC.trna33 | 76| 76|+ |CC |MenT1.r2 | 9423| 11.4| 82775| |Msm.Ala-CGC.trna33 | 76| 76|+ |CCC |ctrl.r1 | 132| 0.2| 75321| |Msm.Ala-CGC.trna33 | 76| 76|+ |CCC |ctrl.r2 | 22| 0.1| 35347| |Msm.Ala-CGC.trna33 | 76| 76|+ |CCC |MenT1.r1 | 49| 0.2| 20841| ``` r palettefig <- c( `3'-` = "#6696D0", `3'-C` = "#E46D32", `3'-CC` = "#B82123", `3'-CCC` = "#F3B81B", `3'-CCCC` = "#D6D65F" ) tRNA_labs = count_table_l$rname labs = tRNA_labs %>% as.character %>% unique %>% str_sub(5,11) names(labs) = tRNA_labs %>% as.character %>% unique count_table_l %>% mutate(rname = fct_relevel(rname, sort(unique(as.character(rname)), decreasing = FALSE)), condition = fct_relevel(condition, sort(unique(as.character(condition)), decreasing = TRUE)), downstream_seq = paste0("3'-", downstream_seq)) %>% ggplot(aes(fill = downstream_seq, y = pc, x = condition)) + geom_bar(position = "stack", stat = "identity") + coord_flip() + scale_fill_manual(values = palettefig) + geom_text(aes(condition, 50, label = total, fill = NULL), size = 3) + theme_classic() + xlab(NULL) + ylab(NULL) + facet_wrap(facets = . ~ rname, ncol = 6, labeller = labeller(rname = labs)) + labs(fill = "3'-end modification") ``` ![](../../vignettes/Post-transcriptional_modifications_files/figure-html/unnamed-chunk-16-1.png) ## Differential proportion analysis: which tRNAs are significantly modified by toxin? Are the observed differences in proportions of 3'-end modified transcripts statistically significant? For this, we will compare the proportion of modified tRNAs in the conrtol *vs.* the proportion of modified tRNAs in the samples treated with MenT1. In the following, we regroup the modified tRNAs as the "fraction" and we sum up unmodified and modified tRNAs in the "total" as expected by `EMOTE_differential_proportion` function. ``` r proportion_table <- count_table_l %>% select(-rlength) %>% mutate(count_of = ifelse(downstream_seq == "", "total", "fraction")) %>% group_by(rname, strand, position, condition, count_of) %>% summarise(count = sum(count), .groups = "keep") %>% separate(condition, into = c("group", "replicate")) %>% pivot_wider(names_from = "count_of", values_from = "count", values_fill=0) %>% mutate(total = total + fraction) %>% # for dss which expects total and fraction pivot_longer(cols = c("fraction", "total"), names_to = "count_of", values_to = "count") %>% mutate(sample_id = paste0(group, ".", replicate, ".", count_of)) %>% select(-group, -replicate, -count_of) proportion_table %>% head(15) %>% knitr::kable() ``` |rname |strand | position| count|sample_id | |:------------------|:------|--------:|------:|:-----------------| |Msm.Ala-CGC.trna33 |+ | 76| 5891|MenT1.r1.fraction | |Msm.Ala-CGC.trna33 |+ | 76| 20841|MenT1.r1.total | |Msm.Ala-CGC.trna33 |+ | 76| 33505|MenT1.r2.fraction | |Msm.Ala-CGC.trna33 |+ | 76| 82775|MenT1.r2.total | |Msm.Ala-CGC.trna33 |+ | 76| 443|ctrl.r1.fraction | |Msm.Ala-CGC.trna33 |+ | 76| 75321|ctrl.r1.total | |Msm.Ala-CGC.trna33 |+ | 76| 79|ctrl.r2.fraction | |Msm.Ala-CGC.trna33 |+ | 76| 35347|ctrl.r2.total | |Msm.Ala-GGC.trna9 |+ | 76| 9965|MenT1.r1.fraction | |Msm.Ala-GGC.trna9 |+ | 76| 33503|MenT1.r1.total | |Msm.Ala-GGC.trna9 |+ | 76| 49391|MenT1.r2.fraction | |Msm.Ala-GGC.trna9 |+ | 76| 141388|MenT1.r2.total | |Msm.Ala-GGC.trna9 |+ | 76| 493|ctrl.r1.fraction | |Msm.Ala-GGC.trna9 |+ | 76| 118259|ctrl.r1.total | |Msm.Ala-GGC.trna9 |+ | 76| 83|ctrl.r2.fraction | Then, we need a `design_matrix` to specify the group and replicate for each `sample_id` and also if the counts in the `count_table` corresponds to the fraction or the total. ``` r design_matrix <- tibble(sample_id = unique(sort(proportion_table$sample_id))) %>% separate(sample_id, sep = "\\.", into = c("group", "replicate", "count_of"), remove = FALSE) design_matrix %>% knitr::kable() ``` |sample_id |group |replicate |count_of | |:-----------------|:-----|:---------|:--------| |ctrl.r1.fraction |ctrl |r1 |fraction | |ctrl.r1.total |ctrl |r1 |total | |ctrl.r2.fraction |ctrl |r2 |fraction | |ctrl.r2.total |ctrl |r2 |total | |MenT1.r1.fraction |MenT1 |r1 |fraction | |MenT1.r1.total |MenT1 |r1 |total | |MenT1.r2.fraction |MenT1 |r2 |fraction | |MenT1.r2.total |MenT1 |r2 |total | ``` r diff_prop <- differential_proportion(proportion_table, design_matrix, group1 = "ctrl", group2 = "MenT1") #> Estimating dispersion for each CpG site, this will take a while ... diff_prop %>% knitr::kable() ``` |rname | position|strand | ctrl| MenT1| pval| fdr| |:------------------|--------:|:------|---------:|---------:|---------:|---------:| |Msm.Gly-TCC.trna14 | 74|+ | 0.0079261| 0.4145317| 0.0000000| 0.0000000| |Msm.Cys-GCA.trna44 | 74|+ | 0.0044360| 0.3793868| 0.0000000| 0.0000000| |Msm.Arg-CCG.trna18 | 76|+ | 0.0020238| 0.3288844| 0.0000000| 0.0000000| |Msm.Ala-GGC.trna9 | 76|+ | 0.0029674| 0.3233828| 0.0000000| 0.0000000| |Msm.Arg-CCT.trna20 | 76|+ | 0.0009950| 0.2765248| 0.0000000| 0.0000000| |Msm.Leu-CAA.trna42 | 77|+ | 0.0014642| 0.2638804| 0.0000000| 0.0000001| |Msm.Leu-CAG.trna3 | 86|+ | 0.0013089| 0.2679313| 0.0000000| 0.0000002| |Msm.Tyr-GTA.trna4 | 86|+ | 0.0000000| 0.2921362| 0.0000001| 0.0000002| |Msm.Asp-GTC.trna31 | 77|+ | 0.0004209| 0.2480578| 0.0000002| 0.0000009| |Msm.Leu-GAG.trna13 | 89|+ | 0.0028787| 0.2463040| 0.0000002| 0.0000009| |Msm.Ala-TGC.trna2 | 76|+ | 0.0009452| 0.2259275| 0.0000003| 0.0000010| |Msm.Ala-CGC.trna33 | 76|+ | 0.0040582| 0.3437180| 0.0000005| 0.0000016| |Msm.SeC-TCA.trna46 | 95|+ | 0.0025000| 0.2309671| 0.0000018| 0.0000052| |Msm.Thr-GGT.trna5 | 76|+ | 0.0009011| 0.2294034| 0.0000039| 0.0000103| |Msm.Lys-CTT.trna17 | 76|+ | 0.0014216| 0.1819812| 0.0000053| 0.0000131| |Msm.Pro-GGG.trna41 | 77|+ | 0.0024442| 0.2546503| 0.0000060| 0.0000138| |Msm.Lys-TTT.trna21 | 76|+ | 0.0009772| 0.1889863| 0.0000068| 0.0000149| |Msm.Ser-GGA.trna24 | 89|+ | 0.0009599| 0.2549558| 0.0000135| 0.0000277| |Msm.Pro-CGG.trna23 | 77|+ | 0.0007758| 0.1714434| 0.0000150| 0.0000293| |Msm.Thr-TGT | 75|+ | 0.0000000| 0.2202381| 0.0000180| 0.0000333| |Msm.Glu-TTC.trna30 | 76|+ | 0.0010123| 0.2098397| 0.0000256| 0.0000450| |Msm.Gln-CTG.trna10 | 75|+ | 0.0025565| 0.1654189| 0.0000555| 0.0000934| |Msm.Asn-GTT.trna37 | 76|+ | 0.0009098| 0.1908387| 0.0000634| 0.0001021| |Msm.Ile-GAT.trna1 | 77|+ | 0.0010778| 0.1727051| 0.0001006| 0.0001551| |Msm.Thr-CGT.trna29 | 76|+ | 0.0015625| 0.1889012| 0.0001962| 0.0002904| |Msm.Val-CAC.trna12 | 75|+ | 0.0015707| 0.1457437| 0.0002308| 0.0003284| |Msm.Val-GAC.trna45 | 75|+ | 0.0010982| 0.1332617| 0.0002644| 0.0003624| |Msm.Gly-GCC.trna43 | 76|+ | 0.0000000| 0.1832386| 0.0003323| 0.0004391| |Msm.His-GTG.trna16 | 76|+ | 0.0000000| 0.1934866| 0.0009273| 0.0011831| |Msm.Ser-CGA.trna28 | 91|+ | 0.0000000| 0.1653512| 0.0011126| 0.0013722| |Msm.Glu-CTC.trna11 | 76|+ | 0.0000000| 0.1664309| 0.0042341| 0.0050001| |Msm.Ser-GCT.trna26 | 92|+ | 0.0000000| 0.1193467| 0.0043244| 0.0050001| |Msm.Met-CAT.trna6 | 77|+ | 0.0000000| 0.0000000| 0.7403609| 0.8218854| |Msm.Met-CAT.trna8 | 77|+ | 0.0000000| 0.0000000| 0.8104833| 0.8218854| |Msm.Pro-TGG.trna36 | 77|+ | 0.0000000| 0.0000000| 0.8057931| 0.8218854| |Msm.Ser-TGA.trna25 | 90|+ | 0.0000000| 0.0000000| 0.8115274| 0.8218854| |Msm.Trp-CCA.trna7 | 76|+ | 0.0000000| 0.0000000| 0.8218854| 0.8218854|